Stem-loop sequence mdo-mir-103-2

AccessionMI0005285 (change log)
DescriptionMonodelphis domestica miR-103-2 stem-loop
Gene family MIPF0000024; mir-103
Stem-loop
   --      g      --   u  u           c   uu   u 
5'   cuuggu cuuuca  gcu cu uacagugcugc uug  gca u
     |||||| ||||||  ||| || ||||||||||| |||  |||  
3'   gaacca gaaagu  cgg ga auguuacgacg aac  ugu g
   ua      a      au   -  c           -   --   a 
Get sequence
Deep sequencing
208879 reads, 3.16e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 727148312-727148395 [-]
sense
ENSMODT00000019620 ; PANK2-201; intron 7
Database links

Mature sequence mdo-miR-103-2-5p

Accession MIMAT0031097
Sequence

13 - 

agcuucuuuacagugcugccuug

 - 35

Get sequence
Deep sequencing135 reads, 4 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-103-3p

Accession MIMAT0004099
Sequence

50 - 

agcagcauuguacagggcuauga

 - 72

Get sequence
Deep sequencing417491 reads, 5 experiments
Evidence experimental; Microarray [1], PCR [1], Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).