Stem-loop sequence mdo-mir-103-1

AccessionMI0005284 (change log)
DescriptionMonodelphis domestica miR-103-1 stem-loop
Gene family MIPF0000024; mir-103
Stem-loop
   --u       --    u  u           c   u g a 
5'    ugucuuc  ggcu cu uacagugcugc uug u c u
      |||||||  |||| || ||||||||||| ||| | |  
3'    acagaag  ucgg ga auguuacgacg aac a g a
   guu       ua    -  c           -   u g u 
Get sequence
Deep sequencing
208869 reads, 3.16e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 367063025-367063100 [-]
sense
ENSMODT00000009077 ; PANK3-201; intron 5
Database links

Mature sequence mdo-miR-103-1-5p

Accession MIMAT0026658
Sequence

7 - 

ucggcuucuuuacagugcugccuug

 - 31

Get sequence
Deep sequencing122 reads, 4 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-103-3p

Accession MIMAT0004099
Sequence

46 - 

agcagcauuguacagggcuauga

 - 68

Get sequence
Deep sequencing417491 reads, 5 experiments
Evidence experimental; Microarray [1], PCR [1], Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).