Stem-loop sequence mdo-mir-101-1

Accession

MI0005283

Description

Monodelphis domestica miR-101-1 stem-loop

Gene family

MIPF0000046; mir-101

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-101_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

miR-101 microRNA precursor is a small non-coding RNA that regulates gene expression. Expression of miR-101 has been validated in both human (MI0000103, MI0000739) and mouse (MI0000148). This microRNA appears to be specific to the vertebrates and has now been predicted or confirmed in a wide range of vertebrate species (MIPF0000046). The precursor microRNA is a stem-loop structure of about 70 nucleotides in length that is processed by the Dicer enzyme to form the 21-24 nucleotide mature microRNA. In this case the mature sequence is excised from the 3' arm of the hairpin.

Stem-loop

a       cuggc                  a    guccg 
 ggcugcc     ucaguuaucacagugcug ugcu     u
 |||||||     |||||||||||||||||| ||||      
 ccgacgg     agucaauagugucaugac augg     u
a       uagga                  -    aacuc 

Genome context

• Coordinates (MonDom5): chr2: 26267862-26267944 [+]
• Overlapping transcripts:

  intergenic

Database links

• ENTREZGENE: 100034324;MIR101-1

Mature sequence mdo-miR-101

• Accession: MIMAT0004098
• Sequence: 51 - uacaguacugugauaacugaag - 72
• Evidence: by similarity; MI0000148
• Predicted targets:
  • TARGETSCAN-VERT:mdo-miR-101

References

1. PMID:17965199 "In vitro and in silico annotation of conserved and nonconserved microRNAs in the genome of the marsupial Monodelphis domestica" Devor EJ, Samollow PB J Hered. 99:66-72(2008).