Stem-loop sequence mdo-mir-101-1

AccessionMI0005283 (change log)
DescriptionMonodelphis domestica miR-101-1 stem-loop
Gene family MIPF0000046; mir-101
Stem-loop
   a       cuggc                  a    guccg 
5'  ggcugcc     ucaguuaucacagugcug ugcu     u
    |||||||     |||||||||||||||||| ||||      
3'  ccgacgg     agucaauagugucaugac augg     u
   a       uagga                  -    aacuc 
Get sequence
Deep sequencing
1120063 reads, 1.64e+04 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 26267862-26267944 [+]
intergenic
Database links

Mature sequence mdo-miR-101-1-5p

Accession MIMAT0031076
Sequence

14 - 

ucaguuaucacagugcugaugcu

 - 36

Get sequence
Deep sequencing337 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-101-3p

Accession MIMAT0004098
Sequence

51 - 

uacaguacugugauaacugaag

 - 72

Get sequence
Deep sequencing2240891 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).