Stem-loop sequence mdo-mir-101-2

AccessionMI0005282 (change log)
DescriptionMonodelphis domestica miR-101-2 stem-loop
Gene family MIPF0000046; mir-101
Stem-loop
     ug  c                    c a    guaua 
5' ac  uc uuuuucgguuaucaugguac g ugcu     u
   ||  || |||||||||||||||||||| | ||||      
3' ug  gg aagaagucaauagugucaug c augg     g
     gu  u                    a -    aaagu 
Get sequence
Deep sequencing
1121183 reads, 1.64e+04 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr6: 166669166-166669244 [+]
sense
ENSMODT00000019545 ; RCL1-201; intron 8
Database links

Mature sequence mdo-miR-101-2-5p

Accession MIMAT0026657
Sequence

12 - 

ucgguuaucaugguaccgaugcu

 - 34

Get sequence
Deep sequencing12 reads, 3 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-101-3p

Accession MIMAT0004098
Sequence

49 - 

uacaguacugugauaacugaag

 - 70

Get sequence
Deep sequencing2240891 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).