Stem-loop sequence mdo-mir-100

AccessionMI0005281 (change log)
DescriptionMonodelphis domestica miR-100 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
       -uu c    a   cg    uc   a      g  au 
5' ccug   g caca acc  uaga  cga cuugug ug  a
   ||||   | |||| |||  ||||  ||| |||||| ||   
3' ggac   c gugu ugg  aucu  guu gaacac ac  u
       ugu u    a   au    gu   c      -  cu 
Get sequence
Deep sequencing
602350 reads, 1.26e+04 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr4: 226180101-226180180 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-100
mdo-mir-100chr4: 226180101-226180180 [+]
mdo-let-7a-2chr4: 226185493-226185565 [+]
Database links

Mature sequence mdo-miR-100-5p

Accession MIMAT0004097
Sequence

13 - 

aacccguagauccgaacuugu

 - 33

Get sequence
Deep sequencing602269 reads, 5 experiments
Evidence experimental; Microarray [1], PCR [1], Illumina [2]
Database links
Predicted targets

Mature sequence mdo-miR-100-3p

Accession MIMAT0026656
Sequence

49 - 

aagcuugugucuauagguaug

 - 69

Get sequence
Deep sequencing81 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).