Stem-loop sequence mdo-mir-34a

AccessionMI0005280 (change log)
DescriptionMonodelphis domestica miR-34a stem-loop
Gene family MIPF0000039; mir-34
Stem-loop
   -    -   --    -  ug     uu        -   a          gugaguaa 
5'  ggcc agc  ugug ag  uuucu  ggcagugu cuu gcugguuguu        u
    |||| |||  |||| ||  |||||  |||||||| ||| ||||||||||         
3'  ccgg uug  gcac uc  gaaga  ccgucaua gaa cgacuaacga        a
   c    a   uu    g  gu     uc        u   -          aggaauag 
Get sequence
Deep sequencing
5081 reads, 20 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr4: 433575257-433575367 [+]
intergenic
Database links

Mature sequence mdo-miR-34a-5p

Accession MIMAT0004096
Sequence

22 - 

uggcagugucuuagcugguuguu

 - 44

Get sequence
Deep sequencing4983 reads, 5 experiments
Evidence experimental; Microarray [1], PCR [1], Illumina [2]
Predicted targets

Mature sequence mdo-miR-34a-3p

Accession MIMAT0026655
Sequence

66 - 

aaucagcaaguauacugcccua

 - 87

Get sequence
Deep sequencing76 reads, 4 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).