Stem-loop sequence mdo-mir-31

AccessionMI0005278 (change log)
DescriptionMonodelphis domestica miR-31 stem-loop
Gene family MIPF0000064; mir-31
Stem-loop
   a    --------     ga     g             -u   gaa 
5'  gcug        gagag  ggcaa auguuggcauagc  guu   c
    ||||        |||||  ||||| |||||||||||||  |||    
3'  cgac        cuuuc  ccguu uacaaccguaucg  caa   u
   a    uaucuguu     ua     a             uc   gag 
Get sequence
Deep sequencing
16205 reads, 320 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr6: 35734628-35734714 [-]
intergenic
Database links

Mature sequence mdo-miR-31-5p

Accession MIMAT0004094
Sequence

10 - 

ggaggcaagauguuggcauagcug

 - 33

Get sequence
Deep sequencing15962 reads, 5 experiments
Evidence experimental; Microarray [1], PCR [1], Illumina [2]
Predicted targets

Mature sequence mdo-miR-31-3p

Accession MIMAT0026653
Sequence

49 - 

gcuaugccaacauauugccauc

 - 70

Get sequence
Deep sequencing236 reads, 2 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).