Stem-loop sequence mdo-mir-30a

AccessionMI0005277 (change log)
DescriptionMonodelphis domestica miR-30a stem-loop
Gene family MIPF0000005; mir-30
Stem-loop
                   uc           g gaagc 
5' gcggcuguaaacaucc  gacuggaagcu u     a
   ||||||||||||||||  ||||||||||| |      
3' cgucgacguuuguagg  cugacuuucgg g     g
                   --           g uagac 
Get sequence
Deep sequencing
4299518 reads, 6.96e+04 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 322692512-322692583 [-]
intergenic
Database links

Mature sequence mdo-miR-30a-5p

Accession MIMAT0004093
Sequence

6 - 

uguaaacauccucgacuggaag

 - 27

Get sequence
Deep sequencing3946108 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mdo-miR-30a-3p

Accession MIMAT0026652
Sequence

49 - 

uuucagucggauguuugcagc

 - 69

Get sequence
Deep sequencing353405 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).