Stem-loop sequence mdo-mir-22

AccessionMI0005276 (change log)
DescriptionMonodelphis domestica miR-22 stem-loop
Gene family MIPF0000053; mir-22
Stem-loop
   cc    ca              -    g       u u  ug 
5'   gagc  cagcaguucuucag uggc agcuuua g cu  u
     ||||  |||||||||||||| |||| ||||||| | ||   
3'   cucg  gucgucaagaaguu accg ucgaaau c ga  c
   gu    -a              g    -       - -  cc 
Get sequence
Deep sequencing
100673 reads, 1.4e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 517205525-517205605 [-]
sense
ENSMODT00000013207 ; SLC43A2-201; intron 2
antisense
ENSMODT00000013102 ; SERPINF2-201; intron 2
Clustered miRNAs
< 10kb from mdo-mir-22
mdo-mir-7268chr2: 517205669-517205727 [-]
mdo-mir-3600chr2: 517205535-517205596 [+]
mdo-mir-22chr2: 517205525-517205605 [-]
Database links

Mature sequence mdo-miR-22-5p

Accession MIMAT0026651
Sequence

13 - 

aguucuucaguggcgagcuuua

 - 34

Get sequence
Deep sequencing5240 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mdo-miR-22-3p

Accession MIMAT0004092
Sequence

51 - 

aagcugccaguugaagaacugc

 - 72

Get sequence
Deep sequencing95433 reads, 5 experiments
Evidence experimental; Microarray [1], PCR [1], Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).