Stem-loop sequence mdo-mir-21

AccessionMI0005275 (change log)
DescriptionMonodelphis domestica miR-21 stem-loop
Gene family MIPF0000060; mir-21
Stem-loop
   --                a     a     a    ugg 
5'   ugucggauagcuuauc gacug uguug cugu   a
     |||||||||||||||| ||||| ||||| ||||    
3'   acagucugucgaguag cugac acaac ggua   u
   uu                -     g     -    cuc 
Get sequence
Deep sequencing
500522 reads, 8.22e+03 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 172169920-172169993 [-]
intergenic
Database links

Mature sequence mdo-miR-21-5p

Accession MIMAT0004091
Sequence

8 - 

uagcuuaucagacugauguuga

 - 29

Get sequence
Deep sequencing500509 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mdo-miR-21-3p

Accession MIMAT0026650
Sequence

47 - 

aacagcagucgaugagcuguc

 - 67

Get sequence
Deep sequencing11 reads, 2 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).