Stem-loop sequence mdo-mir-10b

AccessionMI0005274 (change log)
DescriptionMonodelphis domestica miR-10b stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   ca   u   a  a     u        a    g     c          ---ug  a 
5'   gaa guu uu cguug cuauauau cccu uagaa cgaauuugug     gu u
     ||| ||| || ||||| |||||||| |||| ||||| ||||||||||     ||  
3'   cuu caa aa guagc gguauaua gggg aucuu gcuuagacac     ca u
   ca   -   a  c     u        a    -     a          ugaua  u 
Get sequence
Deep sequencing
1625862 reads, 2.69e+04 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr4: 187496024-187496134 [+]
intergenic
Database links

Mature sequence mdo-miR-10b-5p

Accession MIMAT0004090
Sequence

26 - 

auacccuguagaaccgaauuugu

 - 48

Get sequence
Deep sequencing1625639 reads, 5 experiments
Evidence experimental; Microarray [1], PCR [1], Illumina [2]
Database links
Predicted targets

Mature sequence mdo-miR-10b-3p

Accession MIMAT0026649
Sequence

68 - 

agauucgauucuaggggaaua

 - 88

Get sequence
Deep sequencing215 reads, 3 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).