Stem-loop sequence mdo-mir-10a

AccessionMI0005273 (change log)
DescriptionMonodelphis domestica miR-10a stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   -c    uu        a    g     c          uaaggaa 
5'   uguc  cuguauau cccu uagau cgaauuugug       u
     ||||  |||||||| |||| ||||| ||||||||||        
3'   acag  gauguaua gggg aucua gcuuaaacac       u
   au    uu        a    -     u          ugguguu 
Get sequence
Deep sequencing
1643676 reads, 2.7e+04 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 201156732-201156821 [-]
intergenic
Database links

Mature sequence mdo-miR-10a-5p

Accession MIMAT0004089
Sequence

15 - 

uacccuguagauccgaauuugug

 - 37

Get sequence
Deep sequencing1643283 reads, 5 experiments
Evidence experimental; Microarray [1], PCR [1], Illumina [2]
Database links
Predicted targets

Mature sequence mdo-miR-10a-3p

Accession MIMAT0026648
Sequence

57 - 

aaauucguaucuaggggaaua

 - 77

Get sequence
Deep sequencing375 reads, 3 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).