Stem-loop sequence mdo-mir-9a-1

AccessionMI0005272 (change log)
DescriptionMonodelphis domestica miR-9a-1 stem-loop
Gene family MIPF0000014; mir-9
Stem-loop
   c    cc       -  c               g     gu   a 
5'  gagg  cguuucu cu uuugguuaucuagcu uauga  guu u
    ||||  ||||||| || ||||||||||||||| |||||  |||  
3'  cuuu  guaaaga ga aagccaauagaucga auacu  cga u
   a    ca       u  -               a     au   g 
Get sequence
Deep sequencing
2380757 reads, 3.39e+04 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 122711570-122711659 [-]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-9a-1
mdo-mir-9c-3chr1: 122711587-122711644 [+]
mdo-mir-9a-1chr1: 122711570-122711659 [-]
Database links

Mature sequence mdo-miR-9a-5p

Accession MIMAT0004087
Previous IDsmdo-miR-9
Sequence

16 - 

ucuuugguuaucuagcuguauga

 - 38

Get sequence
Deep sequencing6991910 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mdo-miR-9a-3p

Accession MIMAT0004088
Previous IDsmdo-miR-9*
Sequence

55 - 

auaaagcuagauaaccgaaagu

 - 76

Get sequence
Deep sequencing145444 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1