Stem-loop sequence mdo-mir-1-1

AccessionMI0005269 (change log)
DescriptionMonodelphis domestica miR-1-1 stem-loop
Gene family MIPF0000038; mir-1
Stem-loop
   -       c                     ac     ugaaca 
5'  accuacu agaguacauacuucuuuaugu  ccaua      u
    ||||||| |||||||||||||||||||||  |||||       
3'  uggaugg uuuuauguaugaagaaaugua  gguau      a
   g       u                     -a     cguaac 
Get sequence
Deep sequencing
8430104 reads, 1.12e+05 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr3: 263364374-263364459 [+]
antisense
ENSMODT00000027331 ; MIB1-201; intron 12
Clustered miRNAs
< 10kb from mdo-mir-1-1
mdo-mir-1-1chr3: 263364374-263364459 [+]
mdo-mir-133a-1chr3: 263368065-263368151 [+]
Database links

Mature sequence mdo-miR-1-1-5p

Accession MIMAT0026647
Sequence

14 - 

acauacuucuuuauguacccaua

 - 36

Get sequence
Deep sequencing3 reads, 1 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-1-3p

Accession MIMAT0004085
Sequence

53 - 

uggaauguaaagaaguauguau

 - 74

Get sequence
Deep sequencing16574010 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).