|
miRBase |
|
Stem-loop sequence osa-MIR820c |
|||||
| Accession | MI0005265 | ||||
| Description | Oryza sativa miR820c stem-loop | ||||
| Gene family | MIPF0000348; MIR820 | ||||
| Stem-loop |
u g a - a c u cau g -a u a gcgucg ccucguggauggacc ggagc ucgac uuccuuaaggu guuc uuccgacc acaagguuccgcu ccugc uugu ccaag g |||||| ||||||||||||||| ||||| ||||| ||||||||||| |||| |||||||| ||||||||||||| ||||| |||| ||||| u cgcagc ggagcaccugccugg ccucg agcug aaggaauuccg caag aaggcugg uguuccaagguga ggacg aaca gguuc g a a a u - u c aau a aa - u |
||||
| Deep sequencing |
| ||||
| Comments |
miR820 was misnamed miR583 by Luo et al [1]. |
||||
| Genome context |
|
||||
Mature sequence osa-miR820c |
|
| Accession | MIMAT0004081 |
| Sequence |
5 - ucggccucguggauggaccag - 25 |
| Deep sequencing | 2231 reads, 4 experiments |
| Evidence | experimental; cloned [1], Northern [1-2], MPSS [2], Solexa [3] |
References |
|
| 1 |
PMID:16959252
"Rice embryogenic calli express a unique set of microRNAs, suggesting regulatory roles of microRNAs in plant post-embryogenic development"
FEBS Lett. 580:5111-5116(2006).
|
| 2 |
PMID:18353984
"Genome-wide analysis for discovery of rice microRNAs reveals natural antisense microRNAs (nat-miRNAs)"
Proc Natl Acad Sci U S A. 105:4951-4956(2008).
|
| 3 |
PMID:19903869
"Rice MicroRNA effector complexes and targets"
Plant Cell. 21:3421-3435(2009).
|