Stem-loop sequence osa-MIR820c

AccessionMI0005265 (change log)
DescriptionOryza sativa miR820c stem-loop
Gene family MIPF0000348; MIR820
Literature search

14 open access papers mention osa-MIR820c
(218 sentences)

Stem-loop
   u      g               a     -     a           c    u        cau             g     -a    u     a 
5'  gcgucg ccucguggauggacc ggagc ucgac uuccuuaaggu guuc uuccgacc   acaagguuccgcu ccugc  uugu ccaag g
    |||||| ||||||||||||||| ||||| ||||| ||||||||||| |||| ||||||||   ||||||||||||| |||||  |||| ||||| u
3'  cgcagc ggagcaccugccugg ccucg agcug aaggaauuccg caag aaggcugg   uguuccaagguga ggacg  aaca gguuc g
   a      a               a     u     -           u    c        aau             a     aa    -     u 
Get sequence
Deep sequencing
2637 reads, 1.35e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

miR820 was misnamed miR583 by Luo et al [1].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr10: 6928681-6928871 [+]
intergenic
Database links

Mature sequence osa-miR820c

Accession MIMAT0004081
Sequence

5 - 

ucggccucguggauggaccag

 - 25

Get sequence
Deep sequencing2373 reads, 2 experiments
Evidence experimental; cloned [1], Northern [1-2], MPSS [2], Illumina [3]
Database links

References

1
2
PMID:18353984 "Genome-wide analysis for discovery of rice microRNAs reveals natural antisense microRNAs (nat-miRNAs)" Lu C, Jeong DH, Kulkarni K, Pillay M, Nobuta K, German R, Thatcher SR, Maher C, Zhang L, Ware D, Liu B, Cao X, Meyers BC, Green PJ Proc Natl Acad Sci U S A. 105:4951-4956(2008).
3
PMID:19903869 "Rice MicroRNA effector complexes and targets" Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y Plant Cell. 21:3421-3435(2009).