Stem-loop sequence osa-MIR820b

AccessionMI0005264 (change log)
DescriptionOryza sativa miR820b stem-loop
Gene family MIPF0000348; MIR820
Literature search

11 open access papers mention osa-MIR820b
(212 sentences)

Stem-loop
   guaca       g               ag    -     g           c    u        cau            cg     -a    u     a 
5'      ugcgucg ccucguggauggacc  gagc ucgac uuccuuaaggc guuc uuccgacc   acaagguuccgu  ccugc  uugu ccaag g
        ||||||| |||||||||||||||  |||| ||||| ||||||||||| |||| ||||||||   ||||||||||||  |||||  |||| ||||| u
3'      acgcagc ggagcaccugccugg  uucg agcug aaggaauuccg caag aaggcugg   uguuccaaggug  ggacg  agca gguuc g
   gaucg       a               au    u     -           u    c        aau            aa     aa    -     u 
Get sequence
Deep sequencing
2642 reads, 1.35e+03 reads per million, 2 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Comments

miR820 was misnamed miR583 by Luo et al [1].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr7: 13120534-13120734 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR820b
osa-MIR820bChr7: 13120534-13120734 [-]
osa-MIR172cChr7: 13111485-13111595 [-]
Database links

Mature sequence osa-miR820b

Accession MIMAT0004080
Sequence

10 - 

ucggccucguggauggaccag

 - 30

Get sequence
Deep sequencing2373 reads, 2 experiments
Evidence experimental; cloned [1], Northern [1-2], MPSS [2], Illumina [3]
Database links

References

1
2
PMID:18353984 "Genome-wide analysis for discovery of rice microRNAs reveals natural antisense microRNAs (nat-miRNAs)" Lu C, Jeong DH, Kulkarni K, Pillay M, Nobuta K, German R, Thatcher SR, Maher C, Zhang L, Ware D, Liu B, Cao X, Meyers BC, Green PJ Proc Natl Acad Sci U S A. 105:4951-4956(2008).
3
PMID:19903869 "Rice MicroRNA effector complexes and targets" Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y Plant Cell. 21:3421-3435(2009).