Stem-loop sequence osa-MIR820a

AccessionMI0005263 (change log)
DescriptionOryza sativa miR820a stem-loop
Gene family MIPF0000348; MIR820
Literature search

14 open access papers mention osa-MIR820a
(222 sentences)

Stem-loop
   u c    g    g          a     -  a  a           u    u   a     au            cg     a  gu      a 
5'  g gucg ccuc uggauggacc ggagc uc ac uuccuuaaggu guuc uuc aaccc  acaagguuccac  ccugc uu  uccaag g
    | |||| |||| |||||||||| ||||| || || ||||||||||| |||| ||| |||||  ||||||||||||  ||||| ||  |||||| u
3'  c cagc ggag accugccugg ccucg ag ug aaggaauuccg caag aag uuggg  uguuccaaggug  ggaug aa  agguuc g
   a u    a    g          a     u  c  -           u    c   g     au            aa     a  gu      u 
Get sequence
Deep sequencing
2578 reads, 1.35e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

miR820 was misnamed miR583 by Luo et al [1].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr1: 14130479-14130669 [+]
intergenic
Database links

Mature sequence osa-miR820a

Accession MIMAT0004079
Sequence

5 - 

ucggccucguggauggaccag

 - 25

Get sequence
Deep sequencing2372 reads, 2 experiments
Evidence experimental; cloned [1], Northern [1-2], MPSS [2], Illumina [3]
Database links

References

1
2
PMID:18353984 "Genome-wide analysis for discovery of rice microRNAs reveals natural antisense microRNAs (nat-miRNAs)" Lu C, Jeong DH, Kulkarni K, Pillay M, Nobuta K, German R, Thatcher SR, Maher C, Zhang L, Ware D, Liu B, Cao X, Meyers BC, Green PJ Proc Natl Acad Sci U S A. 105:4951-4956(2008).
3
PMID:19903869 "Rice MicroRNA effector complexes and targets" Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y Plant Cell. 21:3421-3435(2009).