![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence osa-MIR820a |
|||||
Accession | MI0005263 (change log) | ||||
Description | Oryza sativa miR820a stem-loop | ||||
Gene family | MIPF0000348; MIR820 | ||||
Literature search |
![]()
14 open access papers mention osa-MIR820a | ||||
Stem-loop |
u c g g a - a a u u a au cg a gu a 5' g gucg ccuc uggauggacc ggagc uc ac uuccuuaaggu guuc uuc aaccc acaagguuccac ccugc uu uccaag g | |||| |||| |||||||||| ||||| || || ||||||||||| |||| ||| ||||| |||||||||||| ||||| || |||||| u 3' c cagc ggag accugccugg ccucg ag ug aaggaauuccg caag aag uuggg uguuccaaggug ggaug aa agguuc g a u a g a u c - u c g au aa a gu u |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
miR820 was misnamed miR583 by Luo et al [1]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence osa-miR820a |
|
Accession | MIMAT0004079 |
Sequence |
5 - ucggccucguggauggaccag - 25 |
Deep sequencing | 2372 reads, 2 experiments |
Evidence | experimental; cloned [1], Northern [1-2], MPSS [2], Illumina [3] |
Database links |
|
References |
|
1 |
PMID:16959252
"Rice embryogenic calli express a unique set of microRNAs, suggesting regulatory roles of microRNAs in plant post-embryogenic development"
FEBS Lett. 580:5111-5116(2006).
|
2 |
PMID:18353984
"Genome-wide analysis for discovery of rice microRNAs reveals natural antisense microRNAs (nat-miRNAs)"
Proc Natl Acad Sci U S A. 105:4951-4956(2008).
|
3 |
PMID:19903869
"Rice MicroRNA effector complexes and targets"
Plant Cell. 21:3421-3435(2009).
|