Stem-loop sequence osa-MIR818e

AccessionMI0005251 (change log)
DescriptionOryza sativa miR818e stem-loop
Gene family MIPF0000344; MIR818
Literature search

11 open access papers mention osa-MIR818e
(23 sentences)

Stem-loop
     -                                 c   cac               c         uuuuuuuuggaauuauuauuauuuuugacuuauuuuauuaucca 
5' cc ccguccuauaauauaagggauuuugaguuuuug uug   uguuugaccacucgu uuauuuaaa                                            a
   || ||||||||||||||||||||||||||||||||| |||   ||||||||||||||| |||||||||                                             
3' gg ggcaggguauuauauucccuaaaauucaaaaac aac   acaaacuggugagca aauaaguuu                                            a
     a                                 a   aua               a         uuuaaacauguuuauauuuuuugcuuuucaauacgaauuucaug 
Get sequence
Deep sequencing
3070 reads, 250 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

miR818 was misnamed miR580 by Luo et al [1].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr7: 28154432-28154656 [-]
intergenic
Database links

Mature sequence osa-miR818e

Accession MIMAT0004067
Sequence

201 - 

aaucccuuauauuaugggacgg

 - 222

Get sequence
Deep sequencing1801 reads, 2 experiments
Evidence experimental; cloned [1], Northern [1]
Database links

References

1