Stem-loop sequence osa-MIR818d

AccessionMI0005250 (change log)
DescriptionOryza sativa miR818d stem-loop
Gene family MIPF0000344; MIR818
Literature search

12 open access papers mention osa-MIR818d
(30 sentences)

Stem-loop
   u     uu     u          a                          g       cuaga    u 
5'  uccua  aauug uacucucucc ucccauaauauaagggauuuuagagg augugau     uucg a
    |||||  ||||| |||||||||| |||||||||||||||||||||||||| |||||||     |||| g
3'  aggau  uugau augagggagg aggguauuauauucccuaaaaucucc uacacua     gagc u
   a     --     c          c                          a       caaag    c 
Get sequence
Deep sequencing
4026 reads, 300 reads per million, 2 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Comments

miR818 was misnamed miR580 by Luo et al [1].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 34969161-34969299 [-]
intergenic
Database links

Mature sequence osa-miR818d

Accession MIMAT0004066
Sequence

98 - 

aaucccuuauauuaugggacgg

 - 119

Get sequence
Deep sequencing2731 reads, 2 experiments
Evidence experimental; cloned [1], Northern [1]
Database links

References

1