Stem-loop sequence osa-MIR818c

AccessionMI0005249 (change log)
DescriptionOryza sativa miR818c stem-loop
Gene family MIPF0000344; MIR818
Literature search

11 open access papers mention osa-MIR818c
(28 sentences)

Stem-loop
           c     u                        a             auccuagcuauaaccauauaucuagacauagcua 
5' auaauaua ucauu cguccuauaauauaagggauuuug agggaugugacac                                  g
   |||||||| ||||| |||||||||||||||||||||||| |||||||||||||                                  g
3' uauuguau aguag gcaggguauuauauucccuaaaac ucucuauauugug                                  a
           a     -                        c             uauauagaucuguucucguacagaucuauauaca 
Get sequence
Deep sequencing
2508 reads, 250 reads per million, 2 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Comments

miR818 was misnamed miR580 by Luo et al [1].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr2: 35928738-35928913 [+]
intergenic
Database links

Mature sequence osa-miR818c

Accession MIMAT0004065
Sequence

142 - 

aaucccuuauauuaugggacgg

 - 163

Get sequence
Deep sequencing1949 reads, 2 experiments
Evidence experimental; cloned [1], Northern [1]
Database links

References

1