Stem-loop sequence osa-MIR818b

AccessionMI0005248 (change log)
DescriptionOryza sativa miR818b stem-loop
Gene family MIPF0000344; MIR818
Literature search

11 open access papers mention osa-MIR818b
(20 sentences)

Stem-loop
                       a      a             c  cuc      au 
5' ccuccgucccauaauauaag gauuuu gauggaugugaua au   aguaca  g
   |||||||||||||||||||| |||||| ||||||||||||| ||   ||||||  a
3' ggaggcaggguauuauauuc cuaaaa cuaccuauacuau ua   ucaugu  a
                       c      c             a  aua      cu 
Get sequence
Deep sequencing
2723 reads, 150 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

miR818 was misnamed miR580 by Luo et al [1].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr2: 4007190-4007302 [+]
intergenic
Database links

Mature sequence osa-miR818b

Accession MIMAT0004064
Sequence

89 - 

aaucccuuauauuaugggacgg

 - 110

Get sequence
Deep sequencing1803 reads, 2 experiments
Evidence experimental; cloned [1], Northern [1]
Database links

References

1