Stem-loop sequence osa-MIR818a

AccessionMI0005247 (change log)
DescriptionOryza sativa miR818a stem-loop
Gene family MIPF0000344; MIR818
Literature search

10 open access papers mention osa-MIR818a
(19 sentences)

Stem-loop
        -  a                    -   aau            c    u         c      aa 
5' ucccu cc ucccauaguauaagggauuu ggg   gaugugacauau cuag auaaugaau uggaca  c
   ||||| || |||||||||||||||||||| |||   |||||||||||| |||| ||||||||| ||||||  c
3' aggga gg aggguauuauauucccuaaa cuc   cuacacugugua gauc uguuacuua accugu  g
        a  c                    a   -au            u    c         a      cu 
Get sequence
Deep sequencing
2567 reads, 300 reads per million, 2 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Comments

miR818 was misnamed miR580 by Luo et al [1].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr1: 40415422-40415565 [+]
intergenic
Database links

Mature sequence osa-miR818a

Accession MIMAT0004063
Sequence

117 - 

aaucccuuauauuaugggacgg

 - 138

Get sequence
Deep sequencing2122 reads, 2 experiments
Evidence experimental; cloned [1], Northern [1]
Database links

References

1