Stem-loop sequence osa-MIR814c

AccessionMI0005241 (change log)
DescriptionOryza sativa miR814c stem-loop
Gene family MIPF0000351; MIR814
Literature search

2 open access papers mention osa-MIR814c
(7 sentences)

Stem-loop
      ag   u       c      c              - g 
5' acc  aug gacacuu auagua aacgaaucuggaca g a
   |||  ||| ||||||| |||||| |||||||||||||| |  
3' ugg  uau cugugaa uaucau uugcuuaggccugu c a
      cu   c       a      a              a g 
Get sequence
Deep sequencing
938 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

miR814 was misnamed miR573 by Luo et al [1].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr2: 10889672-10889754 [-]
intergenic
Database links

Mature sequence osa-miR814c

Accession MIMAT0004057
Sequence

12 - 

cacuucauaguacaacgaaucu

 - 33

Get sequence
Deep sequencing440 reads, 2 experiments
Evidence experimental; cloned [1], Northern [1]
Database links

References

1