Stem-loop sequence osa-MIR814b

AccessionMI0005240 (change log)
DescriptionOryza sativa miR814b stem-loop
Gene family MIPF0000351; MIR814
Literature search

3 open access papers mention osa-MIR814b
(8 sentences)

Stem-loop
                   c                gga 
5' accggacgagacacuu auaguacaacgaaucu   c
   |||||||||||||||| ||||||||||||||||    
3' uggucugcucugugaa uaucauguugcuuaga   a
                   a                agu 
Get sequence
Deep sequencing
831 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

miR814 was misnamed miR573 by Luo et al [1].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr2: 26341211-26341284 [+]
intergenic
Database links

Mature sequence osa-miR814b

Accession MIMAT0004056
Sequence

12 - 

cacuucauaguacaacgaaucu

 - 33

Get sequence
Deep sequencing377 reads, 2 experiments
Evidence experimental; cloned [1], Northern [1]
Database links

References

1