Stem-loop sequence osa-MIR814a

AccessionMI0005239 (change log)
DescriptionOryza sativa miR814a stem-loop
Gene family MIPF0000351; MIR814
Literature search

3 open access papers mention osa-MIR814a
(8 sentences)

Stem-loop
     c   u      cga                              u 
5' ac uag accgga   gacacuucauaguacaacgaaucuggacag a
   || ||| ||||||   |||||||||||||||||||||||||||||| a
3' ug auc uggccu   cugugaaguaucauguugcuuagaccuguc g
     a   c      aua                              c 
Get sequence
Deep sequencing
1284 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

miR814 was misnamed miR573 by Luo et al [1].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr1: 22375030-22375126 [+]
intergenic
Database links

Mature sequence osa-miR814a

Accession MIMAT0004055
Sequence

19 - 

cacuucauaguacaacgaaucu

 - 40

Get sequence
Deep sequencing427 reads, 2 experiments
Evidence experimental; cloned [1], Northern [1]
Database links

References

1