Stem-loop sequence osa-MIR812e

AccessionMI0005237 (change log)
DescriptionOryza sativa miR812e stem-loop
Gene family MIPF0000345; MIR812
Literature search

9 open access papers mention osa-MIR812e
(15 sentences)

Stem-loop
        a   c     -                             uuuauuacuauuuuuauuguuauuagaugauaaaauaua 
5' guuuu gug ccaac uuugaccguccgucuuauuugaaaauuuu                                       a
   ||||| ||| ||||| |||||||||||||||||||||||||||||                                       a
3' caaag cac gguug aaauuggcaggcagaauaaauuuuuaaaa                                       u
        g   a     c                             uacuuuaaaaaaauuuuuaauucagugcguacuucauua 
Get sequence
Deep sequencing
6854 reads, 1.55e+03 reads per million, 2 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Comments

miR812 was misnamed miR569 by Luo et al [1].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr8: 16401146-16401315 [+]
intergenic
Database links

Mature sequence osa-miR812e

Accession MIMAT0004053
Sequence

141 - 

gacggacgguuaaacguuggac

 - 162

Get sequence
Deep sequencing5068 reads, 2 experiments
Evidence experimental; cloned [1], Northern [1]
Database links

References

1