Stem-loop sequence osa-MIR812d

AccessionMI0005236 (change log)
DescriptionOryza sativa miR812d stem-loop
Gene family MIPF0000345; MIR812
Literature search

10 open access papers mention osa-MIR812d
(16 sentences)

Stem-loop
      a      a       a    c      cgaaaaa     aaaaaaaaacaagucacgcauaaaguauuauuc 
5' cgu uccaac uuugauc ucug cuuauu       uuuau                                 a
   ||| |||||| ||||||| |||| ||||||       |||||                                 u
3' gca agguug aaauugg aggc gaauaa       aaaua                                 g
      c      c       c    a      augaaaa     cuaaucauaaaaauaacaagaauauacuauuuu 
Get sequence
Deep sequencing
3996 reads, 900 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

miR812 was misnamed miR569 by Luo et al [1].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr7: 22395223-22395375 [+]
intergenic
Database links

Mature sequence osa-miR812d

Accession MIMAT0004052
Sequence

129 - 

gacggacgguuaaacguuggac

 - 150

Get sequence
Deep sequencing3769 reads, 2 experiments
Evidence experimental; cloned [1], Northern [1]
Database links

References

1