Stem-loop sequence osa-MIR812c

AccessionMI0005235 (change log)
DescriptionOryza sativa miR812c stem-loop
Gene family MIPF0000345; MIR812
Literature search

9 open access papers mention osa-MIR812c
(15 sentences)

Stem-loop
           c                   a      u   aaaaaauuaaaaacauaagucaugcauaaaauauuauucaug 
5' gguuuccg gucuaauguuugaccgucc ucuuau uga                                          u
   |||||||| ||||||||||||||||||| |||||| |||                                           
3' ccaaaggc cagguugcaaauuggcagg agaaua auu                                          u
           a                   c      u   aaaaaaaaauacuaaccacaauaauaauaacaauuuacuauu 
Get sequence
Deep sequencing
4970 reads, 1.2e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

miR812 was misnamed miR569 by Luo et al [1].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr6: 26260307-26260470 [+]
intergenic
Database links

Mature sequence osa-miR812c

Accession MIMAT0004051
Sequence

134 - 

gacggacgguuaaacguuggac

 - 155

Get sequence
Deep sequencing4378 reads, 2 experiments
Evidence experimental; cloned [1], Northern [1]
Database links

References

1