Stem-loop sequence osa-MIR812b

AccessionMI0005234 (change log)
DescriptionOryza sativa miR812b stem-loop
Gene family MIPF0000345; MIR812
Literature search

9 open access papers mention osa-MIR812b
(15 sentences)

Stem-loop
       c   a    -                               --    aaagauuaaaaaaauagucacgcauaaaguaaua 
5' guau cgu ucua cguuugaccguucgucuuauuugaaaauuuu  auga                                  u
   |||| ||| |||| |||||||||||||||||||||||||||||||  ||||                                  u
3' caua gca aggu gcaaauuggcaggcagaauaaacuuuuaaaa  uacu                                  c
       a   c    u                               au    aaucauaaaaauaacaauaaucuacuauuuugua 
Get sequence
Deep sequencing
7594 reads, 1.65e+03 reads per million, 2 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Comments

miR812 was misnamed miR569 by Luo et al [1].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr2: 1936324-1936493 [-]
intergenic
Database links

Mature sequence osa-miR812b

Accession MIMAT0004050
Sequence

141 - 

gacggacgguuaaacguuggac

 - 162

Get sequence
Deep sequencing4980 reads, 2 experiments
Evidence experimental; cloned [1], Northern [1]
Database links

References

1