Stem-loop sequence osa-MIR812a

AccessionMI0005233 (change log)
DescriptionOryza sativa miR812a stem-loop
Gene family MIPF0000345; MIR812
Literature search

10 open access papers mention osa-MIR812a
(18 sentences)

Stem-loop
           cc                uuacacu    auc     a                          uuu       uuacu       ---uu    -      g      c  g 
5' accuccgu  caaaauaagugcaguu       auuc   uccaa guuugaucguucgucuuauuugaaaa   uuuauga     auuuuua     guua uuacau auaaaa au a
   ||||||||  ||||||||||||||||       ||||   ||||| ||||||||||||||||||||||||||   |||||||     |||||||     |||| |||||| |||||| || a
3' uggaggca  guuuuauucacgucgg       uagg   agguu caaauuggcaggcagaauaaacuuuu   aaauacu     uaaaaau     uaau agugug uauuuu ug u
           aa                -cacuuu    cac     g                          --u       ---uu       uuuuu    c      -      a  a 
Get sequence
Deep sequencing
8874 reads, 2.1e+03 reads per million, 2 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Comments

miR812 was misnamed miR569 by Luo et al [1].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr1: 33947151-33947384 [+]
intergenic
Database links

Mature sequence osa-miR812a

Accession MIMAT0004049
Sequence

175 - 

gacggacgguuaaacguuggac

 - 196

Get sequence
Deep sequencing5160 reads, 2 experiments
Evidence experimental; cloned [1], Northern [1]
Database links

References

1