Stem-loop sequence osa-MIR810a

AccessionMI0005229 (change log)
Previous IDsosa-MIR810
DescriptionOryza sativa miR810a stem-loop
Gene family MIPF0000497; MIR810
Literature search

3 open access papers mention osa-MIR810a
(4 sentences)

Stem-loop
   aauauuc   a      c    a     c                        aaua                             c                             -   u 
5'        acu ugguug cauc uaagc caccacauguggcucgcaugcuua    acuaacggcauaauuagaucacuugauga gacguauaucgguguucgcuauauauacu auc a
          ||| |||||| |||| ||||| ||||||||||||||||||||||||    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||  
3'        uga accagc guag auucg gugguguacaccgagcguacgaau    ugauugccguauuaauuuagugaacuacu cugcguauagccacaagcgauauauauga ugg c
   --uuguu   c      a    c     a                        ----                             a                             a   u 
Get sequence
Deep sequencing
397 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Comments

miR810a was misnamed miR566 by Luo et al [1].

Database links

Mature sequence osa-miR810a

Accession MIMAT0004045
Previous IDsosa-miR810
Sequence

21 - 

ucauaagcccaccacaugugg

 - 41

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; cloned [1], Northern [1]
Database links

References

1