Stem-loop sequence mmu-mir-743a

AccessionMI0005207 (change log)
Previous IDsmmu-mir-743
Symbol MGI:Mir743
DescriptionMus musculus miR-743a stem-loop
Gene family MIPF0000386; mir-743
Literature search

10 open access papers mention mmu-mir-743a
(32 sentences)

Stem-loop
   --  g       a      c  g    guuu 
5'   cu uauucag uuggug cu ucau    a
     || ||||||| |||||| || ||||     
3'   ga augaguc aaccac ga agua    u
   au  g       g      a  a    agaa 
Get sequence
Deep sequencing
47284 reads, 2.31e+03 reads per million, 45 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 66776757-66776818 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-743a
mmu-mir-883achrX: 66780758-66780833 [-]
mmu-mir-742chrX: 66780373-66780437 [-]
mmu-mir-743bchrX: 66777256-66777332 [-]
mmu-mir-743achrX: 66776757-66776818 [-]
Database links

Mature sequence mmu-miR-743a-5p

Accession MIMAT0017263
Previous IDsmmu-miR-743a*
Sequence

4 - 

uauucagauuggugccugucau

 - 25

Get sequence
Deep sequencing3334 reads, 21 experiments
Evidence experimental; Illumina [4]
Database links
Predicted targets

Mature sequence mmu-miR-743a-3p

Accession MIMAT0004238
Previous IDsmmu-miR-743;mmu-miR-743a
Sequence

38 - 

gaaagacaccaagcugaguaga

 - 59

Get sequence
Deep sequencing43949 reads, 45 experiments
Evidence experimental; cloned [1-2], Illumina [3-4]
Database links
Predicted targets

References

1
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).