Stem-loop sequence mmu-mir-742

Accession MI0005206
Symbol MGI:Mir742
Description Mus musculus miR-742 stem-loop
Gene family MIPF0000412; mir-742
Stem-loop 
    c      -      u   aa    g  a 
ugcu uacuca cauggu gcu  ucac ug a
|||| |||||| |||||| |||  |||| || g
auga augggu guacca cga  agug au u
    a      c      c   -a    g  g
Get sequence
Deep sequencing
284 reads, 16 experiments
Genome context
Coordinates (GRCm38) Overlapping transcripts
chrX: 66780373-66780437 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-742
mmu-mir-883b chrX: 66789890-66789967 [-]
mmu-mir-883a chrX: 66780758-66780833 [-]
mmu-mir-742 chrX: 66780373-66780437 [-]
mmu-mir-743b chrX: 66777256-66777332 [-]
mmu-mir-743a chrX: 66776757-66776818 [-]
Database links

Mature sequence mmu-miR-742-5p

Accession MIMAT0004838
Previous IDs mmu-miR-742*
Sequence

6 -  

uacucacaugguugcuaauca

 - 26

Get sequence
Deep sequencing 77 reads, 7 experiments
Evidence experimental; cloned [2], Solexa [4-5]
Predicted targets

Mature sequence mmu-miR-742-3p

Accession MIMAT0004237
Previous IDs mmu-miR-742
Sequence

41 -  

gaaagccaccaugcuggguaaa

 - 62

Get sequence
Deep sequencing 206 reads, 14 experiments
Evidence experimental; cloned [1-2], 454 [3], Solexa [4-5]
Predicted targets

References

1
PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17989215 "RNA sequence analysis defines Dicer's role in mouse embryonic stem cells" Calabrese JM, Seila AC, Yeo GW, Sharp PA Proc Natl Acad Sci U S A. 104:18097-18102(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).