Stem-loop sequence mmu-mir-804

AccessionMI0005203 (change log)
Symbol MGI:Mir804
DescriptionMus musculus miR-804 stem-loop
Literature search

2 open access papers mention mmu-mir-804
(3 sentences)

Stem-loop
     -    -     ca   --u     uu       ccc   ua  c    u 
5' cc cuac acauc  ucu   ugagg  acaacuu   cag  ga uguu c
   || |||| |||||  |||   |||||  |||||||   |||  || ||||  
3' gg ggug uguag  agg   acucc  uguugag   guu  cu acag c
     c    g     -a   ucc     -u       --u   -c  u    u 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr11: 50357785-50357879 [-]
antisense
OTTMUST00000012434 ; Cby3-001; 3'UTR (exon 1)
ENSMUST00000052596 ; Cby3-001; 3'UTR (exon 1)
ENSMUST00000164067 ; Cby3-201; 3'UTR (exon 2)
Database links

Mature sequence mmu-miR-804

Accession MIMAT0004210
Sequence

60 - 

ugugaguuguuccucaccugga

 - 81

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; miRAP-cloned [1]
Predicted targets

References

1
PMID:16973894 "Mouse microRNA profiles determined with a new and sensitive cloning method" Takada S, Berezikov E, Yamashita Y, Lagos-Quintana M, Kloosterman WP, Enomoto M, Hatanaka H, Fujiwara S, Watanabe H, Soda M, Choi YL, Plasterk RH, Cuppen E, Mano H Nucleic Acids Res. 34:e115(2006).