Stem-loop sequence cel-mir-800

AccessionMI0005201 (change log)
DescriptionCaenorhabditis elegans miR-800 stem-loop
Stem-loop
           u               a       cuu 
5' acggcggc gacaauuuccgaguu ggccacu   a
   |||||||| ||||||||||||||| |||||||   u
3' ugccgccg cuguuaaaggcucaa ccgguga   a
           u               a       cua 
Get sequence
Deep sequencing
614 reads, 0 reads per million, 15 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 380919-380991 [-]
intergenic
Database links

Mature sequence cel-miR-800-5p

Accession MIMAT0020354
Previous IDscel-miR-800*
Sequence

9 - 

ugacaauuuccgaguuaggcca

 - 30

Get sequence
Deep sequencing52 reads, 10 experiments
Evidence experimental; Illumina [3]
Database links

Mature sequence cel-miR-800-3p

Accession MIMAT0004235
Previous IDscel-miR-800
Sequence

46 - 

gccaaacucggaaauugucugc

 - 67

Get sequence
Deep sequencing547 reads, 15 experiments
Evidence experimental; 454 [1], Illumina [2-3]
Database links
Predicted targets

References

1
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
2
3