Stem-loop sequence cel-mir-799

AccessionMI0005200 (change log)
DescriptionCaenorhabditis elegans miR-799 stem-loop
Stem-loop
          a  uu       cg      aaa  u    u     -  aa 
5' guuuuuc au  uuuucac  guuuua   ag gguu cacau uc  u
   ||||||| ||  |||||||  ||||||   || |||| ||||| ||   
3' caaaagg ua  aaaggug  cgaaau   uc ccaa gugua ag  a
          c  -u       au      -ag  -    -     c  aa 
Get sequence
Deep sequencing
1490 reads, 14.3 reads per million, 14 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 8600643-8600735 [-]
intergenic
Database links

Mature sequence cel-miR-799

Accession MIMAT0004234
Sequence

58 - 

ugaacccugauaaagcuagugg

 - 79

Get sequence
Deep sequencing1436 reads, 14 experiments
Evidence experimental; 454 [1], Illumina [2], CLIPseq [3]
Database links
Predicted targets

References

1
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
2
3
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).