Stem-loop sequence cel-mir-798

AccessionMI0005199 (change log)
DescriptionCaenorhabditis elegans miR-798 stem-loop
Stem-loop
          u  u  ag    -   a     u   a    u 
5' uacuguu ca gu  gugu uaa guuug aca gaag u
   ||||||| || ||  |||| ||| ||||| ||| |||| a
3' augacga gu ca  uaua auu cgaau ugu cuuu g
          -  -  gu    c   c     -   -    u 
Get sequence
Deep sequencing
465 reads, 0 reads per million, 16 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIV: 14277312-14277387 [-]
antisense
Y64G10A.6 ; Y64G10A.6; intron 1
Database links

Mature sequence cel-miR-798

Accession MIMAT0004233
Sequence

50 - 

uaagccuuacauauugacuga

 - 70

Get sequence
Deep sequencing463 reads, 16 experiments
Evidence experimental; 454 [1], Illumina [2]
Database links
Predicted targets

References

1
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
2