Stem-loop sequence cel-mir-797

AccessionMI0005198 (change log)
DescriptionCaenorhabditis elegans miR-797 stem-loop
Literature search

2 open access papers mention cel-mir-797
(6 sentences)

Stem-loop
      c   ugg     a      c  uca           a  cau 
5' cgu caa   acgau ucacag aa   caaugagaaga ua   c
   ||| |||   ||||| |||||| ||   ||||||||||| ||    
3' gua guu   ugcua aguguc uu   guuacuuuucu au   u
      a   -ua     a      -  -ug           c  aga 
Get sequence
Deep sequencing
583 reads, 0 reads per million, 14 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 4757109-4757197 [+]
intergenic
Clustered miRNAs
< 10kb from cel-mir-797
cel-mir-247chrX: 4756971-4757068 [+]
cel-mir-797chrX: 4757109-4757197 [+]
Database links

Mature sequence cel-miR-797-5p

Accession MIMAT0004232
Previous IDscel-miR-797
Sequence

15 - 

uaucacagcaaucacaaugagaaga

 - 39

Get sequence
Deep sequencing498 reads, 14 experiments
Evidence experimental; 454 [1], Illumina [2], CLIPseq [3]
Database links
Predicted targets

Mature sequence cel-miR-797-3p

Accession MIMAT0015241
Previous IDscel-miR-797*
Sequence

56 - 

uuuucauugguuucugugaaau

 - 77

Get sequence
Deep sequencing85 reads, 10 experiments
Evidence experimental; CLIPseq [3]
Database links
Predicted targets

References

1
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
2
3
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).