Stem-loop sequence cel-mir-796

AccessionMI0005197 (change log)
DescriptionCaenorhabditis elegans miR-796 stem-loop
Stem-loop
        aa       c        a uu      a    -   ca 
5' acucu  ugacaag uggaaugu g  gagguu guaa aag  c
   |||||  ||||||| |||||||| |  |||||| |||| |||  u
3' ugaga  acuguuc gccuugca c  uuccaa cauu uuc  a
        aa       a        - cg      a    g   au 
Get sequence
Deep sequencing
105501 reads, 406 reads per million, 16 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 1798928-1799016 [-]
intergenic
Database links

Mature sequence cel-miR-796

Accession MIMAT0004231
Sequence

16 - 

uggaauguaguugagguuaguaa

 - 38

Get sequence
Deep sequencing105486 reads, 16 experiments
Evidence experimental; 454 [1], Illumina [2]
Database links
Predicted targets

References

1
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
2