Stem-loop sequence cel-mir-795

AccessionMI0005196 (change log)
DescriptionCaenorhabditis elegans miR-795 stem-loop
Literature search

5 open access papers mention cel-mir-795
(7 sentences)

Stem-loop
        --   a    c       g        g   gc    uac 
5' gaaac  guu ccug ugaggua auugauca cga  uuga   c
   |||||  ||| |||| ||||||| |||||||| |||  ||||    
3' uuuug  cga ggac gcuucau ugacuagu gcu  aacu   c
        uu   c    u       a        -   aa    ugc 
Get sequence
Deep sequencing
110341 reads, 247 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrI: 12594569-12594657 [+]
antisense
F33E2.5.1 ; F33E2.5.1; intron 2
Clustered miRNAs
< 10kb from cel-mir-795
cel-mir-795chrI: 12594569-12594657 [+]
cel-mir-794chrI: 12595690-12595773 [+]
Database links

Mature sequence cel-miR-795-5p

Accession MIMAT0004230
Previous IDscel-miR-795
Sequence

15 - 

ugagguagauugaucagcgagcuu

 - 38

Get sequence
Deep sequencing109553 reads, 17 experiments
Evidence experimental; 454 [1], Illumina [2,4], CLIPseq [3]
Database links
Predicted targets

Mature sequence cel-miR-795-3p

Accession MIMAT0020353
Previous IDscel-miR-795*
Sequence

53 - 

aaucgugaucaguauacuucguc

 - 75

Get sequence
Deep sequencing788 reads, 12 experiments
Evidence experimental; Illumina [4]
Database links

References

1
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
2
3
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
4