Stem-loop sequence cel-mir-794

AccessionMI0005195 (change log)
DescriptionCaenorhabditis elegans miR-794 stem-loop
Literature search

6 open access papers mention cel-mir-794
(9 sentences)

Stem-loop
       gcgu    c        au  u    g   c   g  a 
5' cuga    gucu uugaggua  ca cguu uca uuc ca a
   ||||    |||| ||||||||  || |||| ||| ||| ||  
3' gacu    cgga agcucuau  gu gcaa agu aag gu g
       -auu    a        cu  u    a   u   -  u 
Get sequence
Deep sequencing
2030 reads, 0 reads per million, 13 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrI: 12595690-12595773 [+]
antisense
F33E2.5.1 ; F33E2.5.1; intron 2
Clustered miRNAs
< 10kb from cel-mir-794
cel-mir-795chrI: 12594569-12594657 [+]
cel-mir-794chrI: 12595690-12595773 [+]
Database links

Mature sequence cel-miR-794-5p

Accession MIMAT0004229
Previous IDscel-miR-794
Sequence

15 - 

ugagguaaucaucguugucacu

 - 36

Get sequence
Deep sequencing1919 reads, 10 experiments
Evidence experimental; 454 [1], Illumina [2-3]
Database links
Predicted targets

Mature sequence cel-miR-794-3p

Accession MIMAT0020352
Previous IDscel-miR-794*
Sequence

52 - 

ugaaaacguugucuaucucgaa

 - 73

Get sequence
Deep sequencing37 reads, 9 experiments
Evidence experimental; Illumina [3]
Database links

References

1
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
2
3