Stem-loop sequence cel-mir-792

AccessionMI0005193 (change log)
DescriptionCaenorhabditis elegans miR-792 stem-loop
Stem-loop
       ug uc              c  a     uag         a 
5' aagu  g  aacguuugagaguu aa agauu   caauuuuau c
   ||||  |  |||||||||||||| || |||||   |||||||||  
3' uuua  c  uugcagacuuucaa uu ucuaa   guuaaagug g
       gu uu              c  c     --a         a 
Get sequence
Deep sequencing
314 reads, 14.3 reads per million, 14 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrV: 3042092-3042181 [-]
intergenic
Clustered miRNAs
< 10kb from cel-mir-792
cel-mir-1821chrV: 3042530-3042633 [-]
cel-mir-792chrV: 3042092-3042181 [-]
Database links

Mature sequence cel-miR-792-5p

Accession MIMAT0020351
Previous IDscel-miR-792*
Sequence

16 - 

ugagaguucaaaagauuuagcaauu

 - 40

Get sequence
Deep sequencing10 reads, 7 experiments
Evidence experimental; Illumina [3]

Mature sequence cel-miR-792-3p

Accession MIMAT0004227
Previous IDscel-miR-792
Sequence

55 - 

uugaaaucucuucaacuuucaga

 - 77

Get sequence
Deep sequencing286 reads, 12 experiments
Evidence experimental; 454 [1], Illumina [2-3]
Database links
Predicted targets

References

1
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
2
3