Stem-loop sequence cel-mir-791

AccessionMI0005192 (change log)
DescriptionCaenorhabditis elegans miR-791 stem-loop
Gene family MIPF0000370; mir-791
Literature search

1 open access papers mention cel-mir-791
(1 sentences)

Stem-loop
       cu      a       --  uu  a         caa    
5' gaac  ucgauu ccuuauc  cg  gu gccaaaguu   cga 
   ||||  |||||| |||||||  ||  || |||||||||   || a
3' uuug  agcuaa ggaauag  gc  ca cgguuucaa   gcg 
       uu      c       ac  cu  -         -cg    
Get sequence
Deep sequencing
7412 reads, 20 reads per million, 15 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 5809349-5809433 [+]
intergenic
Clustered miRNAs
< 10kb from cel-mir-791
cel-mir-230chrX: 5803892-5803989 [+]
cel-mir-791chrX: 5809349-5809433 [+]
Database links

Mature sequence cel-miR-791-5p

Accession MIMAT0020350
Previous IDscel-miR-791*
Sequence

13 - 

accuuauccguuguagccaaagu

 - 35

Get sequence
Deep sequencing107 reads, 13 experiments
Evidence experimental; Illumina [4]
Database links

Mature sequence cel-miR-791-3p

Accession MIMAT0004226
Previous IDscel-miR-791
Sequence

52 - 

uuuggcacuccgcagauaaggcaa

 - 75

Get sequence
Deep sequencing7305 reads, 14 experiments
Evidence experimental; 454 [1], Illumina [2,4], CLIPseq [3]
Database links
Predicted targets

References

1
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
2
3
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
4