Stem-loop sequence cel-mir-789-2

AccessionMI0005190 (change log)
DescriptionCaenorhabditis elegans miR-789-2 stem-loop
Gene family MIPF0000373; mir-789
Literature search

2 open access papers mention cel-mir-789-2
(2 sentences)

Stem-loop
   u    -  aa   g        a                   uca  a 
5'  gucc ug  ggc gacaauug ugacucaggcagggacuaa   ug u
    |||| ||  ||| |||||||| |||||||||||||||||||   || u
3'  cagg gc  ccg cuguuaac acuggguccgucccugauu   gc g
   a    c  cc   g        c                   -ua  u 
Get sequence
Deep sequencing
4080 reads, 11.8 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIV: 17309307-17309403 [-]
antisense
T28F3.9 ; T28F3.9; intron 2
Database links

Mature sequence cel-miR-789-2-5p

Accession MIMAT0032017
Sequence

17 - 

aauugaugacucaggcagggac

 - 38

Get sequence
Deep sequencing3591 reads, 17 experiments
Evidence experimental; 454 [1]
Database links

Mature sequence cel-miR-789-3p

Accession MIMAT0004224
Previous IDscel-miR-789
Sequence

60 - 

ucccugccugggucaccaauugu

 - 82

Get sequence
Deep sequencing564 reads, 15 experiments
Evidence experimental; 454 [1], Illumina [2]
Database links
Predicted targets

References

1
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
2