Stem-loop sequence cel-mir-789-1

AccessionMI0005189 (change log)
DescriptionCaenorhabditis elegans miR-789-1 stem-loop
Gene family MIPF0000373; mir-789
Literature search

2 open access papers mention cel-mir-789-1
(2 sentences)

Stem-loop
   u    -  aa   a        a        a  a      -   aag 
5'  gucc ug  ggc ggcaauug ugacccag ca ggacua auc   a
    |||| ||  ||| |||||||| |||||||| || |||||| |||   u
3'  cggg gc  ccg cuguuaac acuggguc gu ccugau uag   u
   a    c  cc   g        c        c  c      c   cug 
Get sequence
Deep sequencing
1122 reads, 0 reads per million, 16 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIV: 16740693-16740789 [-]
antisense
Y51H4A.25a ; Y51H4A.25a; intron 3
Y51H4A.25c ; Y51H4A.25c; intron 3
Database links

Mature sequence cel-miR-789-5p

Accession MIMAT0032016
Sequence

17 - 

aauugaugacccagacaaggac

 - 38

Get sequence
Deep sequencing697 reads, 13 experiments
Evidence experimental; 454 [1]
Database links

Mature sequence cel-miR-789-3p

Accession MIMAT0004224
Previous IDscel-miR-789
Sequence

60 - 

ucccugccugggucaccaauugu

 - 82

Get sequence
Deep sequencing564 reads, 15 experiments
Evidence experimental; 454 [1], Illumina [2]
Database links
Predicted targets

References

1
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
2