Stem-loop sequence cel-mir-788

AccessionMI0005188 (change log)
DescriptionCaenorhabditis elegans miR-788 stem-loop
Gene family MIPF0000974; mir-788
Stem-loop
      c          --      cu       g    guuc 
5' gcu acuuuuccgc  uucuaa  uccauuu caga    a
   ||| ||||||||||  ||||||  ||||||| ||||     
3' uga ugaaaaggug  aagauu  agguaaa gucu    a
      u          cu      --       g    aaug 
Get sequence
Deep sequencing
15247 reads, 37.5 reads per million, 16 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 8485294-8485371 [-]
intergenic
Database links

Mature sequence cel-miR-788-5p

Accession MIMAT0004223
Previous IDscel-miR-788
Sequence

10 - 

uccgcuucuaacuuccauuugcag

 - 33

Get sequence
Deep sequencing3570 reads, 15 experiments
Evidence experimental; 454 [1], Illumina [2,4], CLIPseq [3]
Database links
Predicted targets

Mature sequence cel-miR-788-3p

Accession MIMAT0015240
Previous IDscel-miR-788*
Sequence

48 - 

ggaaauggauuagaaucguggaaa

 - 71

Get sequence
Deep sequencing11664 reads, 16 experiments
Evidence experimental; CLIPseq [3], Illumina [4]
Database links
Predicted targets

References

1
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
2
3
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
4