Stem-loop sequence cel-mir-787

AccessionMI0005187 (change log)
DescriptionCaenorhabditis elegans miR-787 stem-loop
Gene family MIPF0000364; mir-787
Literature search

1 open access papers mention cel-mir-787
(2 sentences)

Stem-loop
        -     u             --au    u       -  uc 
5' gaugu aucag ggacgaaagauac    acga cuuacau cu  a
   ||||| ||||| |||||||||||||    |||| ||||||| ||  a
3' uuaca uaguc ucugcuuucuaug    ugcu gaaugua gg  a
        c     -             auuu    c       u  ua 
Get sequence
Deep sequencing
1764 reads, 0 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 11294708-11294797 [+]
intergenic
Database links

Mature sequence cel-miR-787-5p

Accession MIMAT0020348
Previous IDscel-miR-787*
Sequence

17 - 

aaagauacauacgaucuuaca

 - 37

Get sequence
Deep sequencing16 reads, 7 experiments
Evidence experimental; Illumina [3]

Mature sequence cel-miR-787-3p

Accession MIMAT0004222
Previous IDscel-miR-787
Sequence

54 - 

uaagcucguuuuaguaucuuucg

 - 76

Get sequence
Deep sequencing1748 reads, 15 experiments
Evidence experimental; 454 [1], Illumina [2-3]
Database links
Predicted targets

References

1
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
2
3