Stem-loop sequence cel-mir-786

AccessionMI0005186 (change log)
DescriptionCaenorhabditis elegans miR-786 stem-loop
Gene family MIPF0000363; mir-786
Literature search

3 open access papers mention cel-mir-786
(7 sentences)

Stem-loop
        -a  uc     c        g ug       u    aaag 
5' gggau  gu  ccgau gaauauca u  ggguauu acaa    a
   |||||  ||  ||||| |||||||| |  ||||||| ||||     
3' cucua  ua  ggcua cuuguagu a  cccguaa uguu    c
        ag  gu     a        a gu       -    aaaa 
Get sequence
Deep sequencing
31253 reads, 200 reads per million, 14 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 7882751-7882840 [+]
intergenic
Clustered miRNAs
< 10kb from cel-mir-786
cel-mir-240chrX: 7882622-7882718 [+]
cel-mir-786chrX: 7882751-7882840 [+]
cel-mir-8203chrX: 7882764-7882824 [-]
Database links

Mature sequence cel-miR-786-5p

Accession MIMAT0015239
Previous IDscel-miR-786*
Sequence

16 - 

cgaauaucaguugggguauuuaca

 - 39

Get sequence
Deep sequencing1123 reads, 11 experiments
Evidence experimental; CLIPseq [3]
Database links
Predicted targets

Mature sequence cel-miR-786-3p

Accession MIMAT0004221
Previous IDscel-miR-786
Sequence

54 - 

uaaugcccugaaugauguucaau

 - 76

Get sequence
Deep sequencing30128 reads, 14 experiments
Evidence experimental; 454 [1], Illumina [2], CLIPseq [3]
Database links
Predicted targets

References

1
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
2
3
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).