Stem-loop sequence cel-mir-785

AccessionMI0005185 (change log)
DescriptionCaenorhabditis elegans miR-785 stem-loop
Gene family MIPF0000896; mir-785
Stem-loop
       uu    u    c   a         uu      a   gaaacc 
5' gcuc  uuuc cacc auc gcacagaau  uucgcu aca      u
   ||||  |||| |||| ||| |||||||||  |||||| |||      c
3' cgag  aaag gugg uag uguguuuug  aaguga ugu      a
       -u    -    -   a         uu      a   aacaaa 
Get sequence
Deep sequencing
11176 reads, 0 reads per million, 16 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 3004668-3004761 [+]
intergenic
Clustered miRNAs
< 10kb from cel-mir-785
cel-mir-359chrX: 3004291-3004400 [+]
cel-mir-785chrX: 3004668-3004761 [+]
cel-mir-249chrX: 3006440-3006536 [-]
Database links

Mature sequence cel-miR-785-5p

Accession MIMAT0032015
Sequence

20 - 

agcacagaauuuuucgcuaaca

 - 41

Get sequence
Deep sequencing4 reads, 3 experiments
Evidence experimental; 454 [1]

Mature sequence cel-miR-785-3p

Accession MIMAT0004220
Previous IDscel-miR-785
Sequence

59 - 

uaagugaauuguuuuguguaga

 - 80

Get sequence
Deep sequencing11164 reads, 16 experiments
Evidence experimental; 454 [1], Illumina [2], CLIPseq [3]
Database links
Predicted targets

References

1
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
2
3
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).