Stem-loop sequence cel-mir-784

AccessionMI0005184 (change log)
DescriptionCaenorhabditis elegans miR-784 stem-loop
Literature search

1 open access papers mention cel-mir-784
(6 sentences)

Stem-loop
   u   ac  -   c ug  a    c gc          -a   ca 
5'  ucg  gu cca g  gc caau u  guacguagaa  gau  a
    |||  || ||| |  || |||| |  ||||||||||  |||   
3'  agu  ca ggu c  cg guug a  cauguaucuu  cug  a
   a   ga  c   c gu  c    u aa          ca   aa 
Get sequence
Deep sequencing
2896 reads, 18.2 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 8074922-8075009 [-]
intergenic
Clustered miRNAs
< 10kb from cel-mir-784
cel-mir-5553chrX: 8077555-8077664 [-]
cel-mir-784chrX: 8074922-8075009 [-]
Database links

Mature sequence cel-miR-784-5p

Accession MIMAT0004219
Previous IDscel-miR-784
Sequence

14 - 

uggcacaaucugcguacguaga

 - 35

Get sequence
Deep sequencing2885 reads, 11 experiments
Evidence experimental; 454 [1], Illumina [2-3]
Database links
Predicted targets

Mature sequence cel-miR-784-3p

Accession MIMAT0020347
Previous IDscel-miR-784*
Sequence

55 - 

uauguacaaauguugcgcugcc

 - 76

Get sequence
Deep sequencing10 reads, 6 experiments
Evidence experimental; Illumina [3]

References

1
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
2
3